The cytoplasmic lipid droplet (CLD) protein perilipin-2 (Plin2) is expressed in multiple nonadipose tissues, where it is thought to play a role in regulating their lipid storage properties. However, the extent to which Plin2 functions in nutrient utilization and metabolism, or how it influences the consequences of over-feeding, remains unclear. In this study, we demonstrate that the absence of Plin2 prevents high-fat diet(HFD)-induced obesity in male and female mice. This response is associated with increased formation of subcutaneous beige adipocyte cells with uncoupling protein 1 expression, and amelioration of inflammatory foci formation in white adipose tissue and steatosis in the liver. Experiments demonstrate that Plin2 loss results in reduced energy intake and increased physical activity in response to HFD feeding. Our study provides the first evidence that Plin2 contributes to HFD-induced obesity by modulating food intake, and that its absence prevents obesity-associated adipose tissue inflammatory foci and liver steatosis. The cytoplasmic lipid droplet (CLD) protein perilipin-2 (Plin2) is expressed in multiple nonadipose tissues, where it is thought to play a role in regulating their lipid storage properties. However, the extent to which Plin2 functions in nutrient utilization and metabolism, or how it influences the consequences of over-feeding, remains unclear. In this study, we demonstrate that the absence of Plin2 prevents high-fat diet(HFD)-induced obesity in male and female mice. This response is associated with increased formation of subcutaneous beige adipocyte cells with uncoupling protein 1 expression, and amelioration of inflammatory foci formation in white adipose tissue and steatosis in the liver. Experiments demonstrate that Plin2 loss results in reduced energy intake and increased physical activity in response to HFD feeding. Our study provides the first evidence that Plin2 contributes to HFD-induced obesity by modulating food intake, and that its absence prevents obesity-associated adipose tissue inflammatory foci and liver steatosis. Obesity, resulting from increased calorie consumption and decreased energy expenditure, remains a major public health concern for children and adults in the United States (1Catenacci V.A. Hill J.O. Wyatt H.R. The obesity epidemic.Clin. Chest Med. 2009; 30: 415-444Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar), through its strong etiological links to several metabolic complications, including metabolic syndrome, type 2 diabetes, and nonalcoholic fatty liver disease (NAFLD) (2Unger R.H. Clark G.O. Scherer P.E. Orci L. Lipid homeostasis, lipotoxicity and the metabolic syndrome.Biochim. Biophys. Acta. 2010; 1801: 209-214Crossref PubMed Scopus (440) Google Scholar). Obesity-associated NAFLD in particular is associated with development of hyperlipidemia, insulin resistance, hyperglycemia (3Fabbrini E. Magkos F. Mohammed B.S. Pietka T. Abumrad N.A. Patterson B.W. Okunade A. Klein S. Intrahepatic fat, not visceral fat, is linked with metabolic complications of obesity.Proc. Natl. Acad. Sci. USA. 2009; 106: 15430-15435Crossref PubMed Scopus (745) Google Scholar), and increased risk of liver cancer (4Torres D.M. Harrison S.A. Nonalcoholic steatohepatitis and noncirrhotic hepatocellular carcinoma: fertile soil.Semin. Liver Dis. 2012; 32: 30-38Crossref PubMed Scopus (90) Google Scholar, 5Wang Y. Ausman L.M. Greenberg A.S. Russell R.M. Wang X.D. Nonalcoholic steatohepatitis induced by a high-fat diet promotes diethylnitrosamine-initiated early hepatocarcinogenesis in rats.Int. J. Cancer. 2009; 124: 540-546Crossref PubMed Scopus (61) Google Scholar). In tissues, neutral lipids such as triacylglycerol are stored in cytoplasmic lipid droplets (CLDs), which are specialized organelle-like structures that function in intracellular trafficking and metabolism of lipids (6Murphy S. Martin S. Parton R.G. Lipid droplet-organelle interactions; sharing the fats.Biochim. Biophys. Acta. 2009; 1791: 441-447Crossref PubMed Scopus (213) Google Scholar). Alterations in CLD properties are increasingly recognized to be associated with metabolic abnormalities and disruptions of normal cellular and tissue functions (7Greenberg A.S. Coleman R.A. Kraemer F.B. McManaman J.L. Obin M.S. Puri V. Yan Q.W. Miyoshi H. Mashek D.G. The role of lipid droplets in metabolic disease in rodents and humans.J. Clin. Invest. 2011; 121: 2102-2110Crossref PubMed Scopus (454) Google Scholar). Perilipins (PLINs) are a family of genes encoding five CLD-associated proteins in mammals that are implicated in the regulation of storage and hydrolysis of neutral lipids (7Greenberg A.S. Coleman R.A. Kraemer F.B. McManaman J.L. Obin M.S. Puri V. Yan Q.W. Miyoshi H. Mashek D.G. The role of lipid droplets in metabolic disease in rodents and humans.J. Clin. Invest. 2011; 121: 2102-2110Crossref PubMed Scopus (454) Google Scholar, 8Brasaemle D.L. The perilipin family of structural lipid droplet proteins: stabilization of lipid droplets and control of lipolysis.J. Lipid Res. 2007; 48: 2547-2549Abstract Full Text Full Text PDF PubMed Scopus (757) Google Scholar). Prior studies investigating reduced expression of perilipin1 (Plin1) in mice demonstrated that it is required for normal adipose lipid storage (9Martinez-Botas J. Anderson J.B. Tessier D. Lapillonne A. Chang B.H. Quast M.J. Gorenstein D. Chen K.H. Chan L. Absence of perilipin results in leanness and reverses obesity in Lepr(db/db) mice.Nat. Genet. 2000; 26: 474-479Crossref PubMed Scopus (491) Google Scholar, 10Tansey J.T. Sztalryd C. Gruia-Gray J. Roush D.L. Zee J.V. Gavrilova O. Reitman M.L. Deng C.X. Li C. Kimmel A.R. et al.Perilipin ablation results in a lean mouse with aberrant adipocyte lipolysis, enhanced leptin production, and resistance to diet-induced obesity.Proc. Natl. Acad. Sci. USA. 2001; 98: 6494-6499Crossref PubMed Scopus (604) Google Scholar, 11Souza S.C. de Vargas L.M. Yamamoto M.T. Lien P. Franciosa M.D. Moss L.G. Greenberg A.S. Overexpression of perilipin A and B blocks the ability of tumor necrosis factor alpha to increase lipolysis in 3T3-L1 adipocytes.J. Biol. Chem. 1998; 273: 24665-24669Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar), whereas reduced perilipin-2 (Plin2) expression prevents hepatic lipid accumulation in response to high-fat diet (HFD) feeding (12Chang B.H. Li L. Paul A. Taniguchi S. Nannegari V. Heird W.C. Chan L. Protection against fatty liver but normal adipogenesis in mice lacking adipose differentiation-related protein.Mol. Cell. Biol. 2006; 26: 1063-1076Crossref PubMed Scopus (256) Google Scholar, 13Imai Y. Varela G.M. Jackson M.B. Graham M.J. Crooke R.M. Ahima R.S. Reduction of hepatosteatosis and lipid levels by an adipose differentiation-related protein antisense oligonucleotide.Gastroenterology. 2007; 132: 1947-1954Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 14Varela G.M. Antwi D.A. Dhir R. Yin X. Singhal N.S. Graham M.J. Crooke R.M. Ahima R.S. Inhibition of ADRP prevents diet-induced insulin resistance.Am. J. Physiol. Gastrointest. Liver Physiol. 2008; 295: G621-G628Crossref PubMed Scopus (91) Google Scholar). Although Plin1-null mice are also resistant to obesity and many of its attendant metabolic abnormalities (9Martinez-Botas J. Anderson J.B. Tessier D. Lapillonne A. Chang B.H. Quast M.J. Gorenstein D. Chen K.H. Chan L. Absence of perilipin results in leanness and reverses obesity in Lepr(db/db) mice.Nat. Genet. 2000; 26: 474-479Crossref PubMed Scopus (491) Google Scholar, 10Tansey J.T. Sztalryd C. Gruia-Gray J. Roush D.L. Zee J.V. Gavrilova O. Reitman M.L. Deng C.X. Li C. Kimmel A.R. et al.Perilipin ablation results in a lean mouse with aberrant adipocyte lipolysis, enhanced leptin production, and resistance to diet-induced obesity.Proc. Natl. Acad. Sci. USA. 2001; 98: 6494-6499Crossref PubMed Scopus (604) Google Scholar), there is limited understanding of the contributions of Plin2, or other PLIN family members, to obesity or other metabolic disorders. Defining the roles of Plin2 in obesity and metabolism has been complicated by observations that existing Plin2-deficient mice produce a truncated product that is biologically active (15Russell T.D. Palmer C.A. Orlicky D.J. Bales E.S. Chang B.H. Chan L. McManaman J.L. Mammary glands of adipophilin-null mice produce an amino-terminally truncated form of adipophilin that mediates milk lipid droplet formation and secretion.J. Lipid Res. 2008; 49: 206-216Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar), and that the short-term-diet models used previously did not adequately investigate Plin2 regulation of body fat accumulation (12Chang B.H. Li L. Paul A. Taniguchi S. Nannegari V. Heird W.C. Chan L. Protection against fatty liver but normal adipogenesis in mice lacking adipose differentiation-related protein.Mol. Cell. Biol. 2006; 26: 1063-1076Crossref PubMed Scopus (256) Google Scholar, 13Imai Y. Varela G.M. Jackson M.B. Graham M.J. Crooke R.M. Ahima R.S. Reduction of hepatosteatosis and lipid levels by an adipose differentiation-related protein antisense oligonucleotide.Gastroenterology. 2007; 132: 1947-1954Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). To explore the functional importance of Plin2 in obesity and other aspects of lipid metabolism, we generated a new conditional line of mice in which the Plin2 locus was disrupted by targeted removal of exon 5. In this paper, we document that mice lacking Plin2 are resistant to HFD-induced obesity. Our studies further show that Plin2 loss prevents HFD-induced obesity largely by limiting energy intake and altering locomotor activity. Chemicals used were purchased from Sigma Chemical Co. (St. Louis, MO). Antibodies to N- and C-terminal regions of Plin2 and to Plin3 were raised in rabbits as described (15Russell T.D. Palmer C.A. Orlicky D.J. Bales E.S. Chang B.H. Chan L. McManaman J.L. Mammary glands of adipophilin-null mice produce an amino-terminally truncated form of adipophilin that mediates milk lipid droplet formation and secretion.J. Lipid Res. 2008; 49: 206-216Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Guinea pig antibodies to mouse Plin1, Plin4, and Plin5 were purchased from Fitzgerald (North Acton, MA). Antibodies to mouse F4/80 were purchased from Serotec (Raleigh, NC). HRP-conjugated and Alexfluor-conjugated secondary antibodies were purchased from Life Technologies (Grand Island, NY). HF (60 kcal%; D12492) and low-fat (10 kcal%, D12045B) diets were purchased from Research Diets, Inc. (New Brunswick, NJ). Mice lacking exon 5 of the Plin2 locus were generated using a targeting strategy that deleted 1.8 kb of the genomic sequence containing the murine Plin2 exon 5, resulting in out-of-frame splicing between exons 4 and 6 (Fig. 1). A Flip recombinase target site (FRT)-neomycin-FRT-loxP cassette and a distal loxP site were inserted into introns 4 and 5, respectively, of a mouse genomic DNA encompassing Plin2 gene regions surrounding exon 5 that was cloned from a 129Sv/Pas miniBAC library (genOway; Lyon, France) and that is isogenic to the ES cell line used for homologous recombination. Short- and long-homology arms were generated using the following sets of primer pair sequences: Short-homology arm, forward, CGTGGGTAGCTTTATTTCCTGAGTGACG, and reverse, CATAGGTATTGGCAACCGCAACTGC, amplify a 345 bp segment in intron 3 and exon 4 of Plin2. Long-homology arm, forward, TGGTGCATAGTACCTGCCTTCAAATGG, and reverse, TGGTGCATAGTACCTGCCTTCAAATGG, amplify a 549 bp segment in intron 7 of murine Plin2. 129/SvPas ES cells, containing an agouti coat color marker, were transfected with the linearized targeting vector and selected in G418-containing media. Homologous recombinations were identified by PCR and Southern blotting. Targeted ES clones were injected into C57BL/6 blastocysts. Recombinant animals, identified by coat color and PCR genotyping, were crossed with C57BL/6-expressing Cre-recombinase-expressing mice (CMV-Cre, genOway), and offspring were genotyped by PCR to identify those that were heterozygous for the knockout genotype. The knockout genotype of PCR-positive animals was confirmed by Southern blot analysis. Heterozygous knockout animals were backcrossed to C57BL/6 mice for 15 generations to generate congenic C57Bl/6-Plin2(Δ5) mice. Wild-type (WT) and Plin2(Δ5) mice were genotyped by PCR using the following mixture of primer sequences that target exon 5 and adjacent intronic regions of the mouse Plin2 locus: 5′- AGC AAC CTG ATG GAG ACA CTC AG -3′(forward); 5′- CAC TGT TCA TGA ACT GCA CCA TC -3′(reverse 1); 5′- CCG AGA GCA GAG CTT GGT AGA -3′(reverse 2). Mice were housed in the University of Colorado School of Medicine舗s Center for Comparative Medicine at ambient temperatures of 22–24°C on a 12:12 h light-dark cycle with free access to food and water for the study舗s duration. All mice were fed standard mouse chow ad libitum from weaning to 8 weeks of age, at which time they were placed on isocaloric diets containing 60% fat calories (D12492) or 10% fat calories (D12450B) from Research Diets, Inc. Body weights were measured at weekly cage changes. Upon completion of the feeding experiments, determination of the body composition of each animal was performed by quantitative magnetic resonance EchoMRI-900 whole-body composition analyzer (Echo Medical Systems; Houston, TX), and blood samples were taken for serum analysis. For fasting-feeding experiments, male mice were fasted for 24 h then refed with the 60% fat calorie diet for 16 h. At the termination of each experiment, mice were injected with sodium pentobarbital to induce anesthesia and euthanized by exsanguination. After euthanization, organs and tissues were removed from each animal, weighed, and processed for histological, immunohistochemical, and biochemical analyses. The University of Colorado School of Medicine Institutional Animal Care and Use Committee approved all procedures. Three separate cohorts of mice were placed in a metabolic monitoring system that provided measurements of energy balance (intake and expenditure), the respiratory exchange ratio (RER), and activity levels (Columbus, OH; 8M Oxymax) (16Wahlig J.L. Bales E.S. Jackman M.R. Johnson G.C. McManaman J.L. Maclean P.S. Impact of high-fat diet and obesity on energy balance and fuel utilization during the metabolic challenge of lactation.Obesity (Silver Spring). 2012; 20: 65-75Crossref PubMed Scopus (40) Google Scholar). Mice were individually housed in metabolic chambers after 9 weeks of HF feeding. Metabolic measurements were made following a 3 day lead-in to allow the mice to adjust to the chambers. Freshly dissected organ and tissue sections were processed for hematoxylin-and-eosin (H and E) staining and immunofluorescence microscopy as described previously (17Russell T.D. Palmer C.A. Orlicky D.J. Fischer A. Rudolph M.C. Neville M.C. McManaman J.L. Cytoplasmic lipid droplet accumulation in developing mammary epithelial cells: roles of adipophilin and lipid metabolism.J. Lipid Res. 2007; 48: 1463-1475Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Immunoreactivity was visualized using secondary antibodies conjugated with Alexafluor 488 or Alexafluor 594 at dilutions of 1:500 and 1:250, respectively. Nuclei were stained with (4′,6-diamidino-2-phenylindole (Sigma Chemical Co.). Immunofluorescence images were captured on a Nikon Diaphot fluorescence microscope and digitally deconvolved using the No Neighbors algorithm (Slidebook; Denver, CO) as described previously (17Russell T.D. Palmer C.A. Orlicky D.J. Fischer A. Rudolph M.C. Neville M.C. McManaman J.L. Cytoplasmic lipid droplet accumulation in developing mammary epithelial cells: roles of adipophilin and lipid metabolism.J. Lipid Res. 2007; 48: 1463-1475Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Histologic images were captured on an Olympus BX51 microscope equipped with a four megapixel Macrofire digital camera (Optronics; Goleta, CA) using the PictureFrame Application 2.3 (Optronics). All images were cropped and assembled using Photoshop CS2 (Adobe Systems, Inc.; Mountain View, CA). Total RNA was extracted and its purity and integrity quantified as described previously (15Russell T.D. Palmer C.A. Orlicky D.J. Bales E.S. Chang B.H. Chan L. McManaman J.L. Mammary glands of adipophilin-null mice produce an amino-terminally truncated form of adipophilin that mediates milk lipid droplet formation and secretion.J. Lipid Res. 2008; 49: 206-216Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). PLIN family transcript copy numbers were determined by quantitative real-time PCR (qRT-PCR) analysis by the Quantitative Genomics Core Laboratory at the University of Texas Health Sciences Center using a multiplexing strategy, with validated primer-probe sets and 18S rRNA as a standard (15Russell T.D. Palmer C.A. Orlicky D.J. Bales E.S. Chang B.H. Chan L. McManaman J.L. Mammary glands of adipophilin-null mice produce an amino-terminally truncated form of adipophilin that mediates milk lipid droplet formation and secretion.J. Lipid Res. 2008; 49: 206-216Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). The primers and probes used for qRT-PCR analyses are listed in Table 1 in the supplementary data. Three tissue replicates at each time point were analyzed.TABLE 1Serum hormone and lipid levelsWTD5KOt-testLeptin (ng/ml)12.7 ± 3.64.7 ± 0.8P < 0.05Insulin (ng/ml)2.7 ± 0.71.1 ± 0.3P < 0.07Triglycerides (mg/dl)31.5 ± 3.524.0 ± 1.4P < 0.00005FAs (mM)1.2 ± 0.20.8 ± 0.2P < 0.01Fasting serum hormone and lipid levels in WT and Plin2(Δ5) mice fed the HF diet for 12 weeks. Open table in a new tab Fasting serum hormone and lipid levels in WT and Plin2(Δ5) mice fed the HF diet for 12 weeks. Liver samples were homogenized on ice with glass-on-glass grinding tubes in homogenization buffer (20 mM Tris-HCl, pH 7.4; 150 mM NaCl; 1% NP-40; 20 mM NaF; 2 mM EDTA, pH 8.0; 2.5 mM NaPP; 20 mM β-glycerophosphate; 1% glycerol; ddH2O) plus protease and phosphatase inhibitors (aprotinin, leupeptin, pepstatin, AEBSF, PIC1, PIC2). Protein concentration was measured using the DC Protein Assay Kit II (Bio-Rad Laboratories; Hercules, CA). Fifty microgram amounts of total protein were separated on 7.5% SDS-polyacrylamide gels, transferred to a 0.2 μm nitrocellulose membrane, and probed with the 1/1,000 dilutions of rabbit antibodies to the N- and C-terminal regions of Plin2 (17Russell T.D. Palmer C.A. Orlicky D.J. Fischer A. Rudolph M.C. Neville M.C. McManaman J.L. Cytoplasmic lipid droplet accumulation in developing mammary epithelial cells: roles of adipophilin and lipid metabolism.J. Lipid Res. 2007; 48: 1463-1475Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Corresponding HRP-conjugated secondary antibodies were used at 1/5,000 dilution. Bands were detected using SuperSignal West Pico chemiluminescent substrate (Thermo Fisher Scientific, Inc.; Rockford, IL), and band intensities were quantified by densitometry using the ChemiDoc system (Bio-Rad Laboratories). Data were analyzed by Students t-test. Statistical significance was assumed when P ≤ 0.05. We generated Plin2(Δ5) mice by crossing transgenic mice harboring loxP sites flanking exon 5 of the Plin2 locus with C57BL/6 mice globally expressing Cre-recombinase, including in the germ line (Fig. 1A). Subsequently, the Cre gene was removed by mating, yielding mice expressing a mutated Plin2 locus under control of the CMV promoter in the absence of Cre expression. Mutant Plin2(Δ5) mice on a mixed C57BL/6-129 background were then backcrossed with C57BL/6 males for over 15 generations. Congenic C57BL/6 mice lacking the Plin2 gene were identified by PCR analysis (see supplementary Fig. I). Primer sequences targeted to exon 5 and adjacent intronic regions (see Methods) amplified a 387 bp band in WT mice and a 300 bp band in Plin2(Δ5) mice. Excision of exon 5 was predicted to produce a truncated transcript in which exons 4 and 6 are fused, generating a frame-shift mutation and a premature stop codon in exon 7 that we hypothesized would result in degradation of the Plin2 mRNA (Fig. 1A). We investigated whether exon 5 deletion disrupts Plin2 expression by determining Plin2 transcript and protein levels in livers of WT and Plin2(Δ5) mice that had been fasted and then refed with a 60% fat diet. A fasting-and-refeeding protocol has previously been demonstrated to significantly increase hepatic Plin2 mRNA and protein expression (18Dalen K.T. Ulven S.M. Arntsen B.M. Solaas K. Nebb H.I. PPARalpha activators and fasting induce the expression of adipose differentiation-related protein in liver.J. Lipid Res. 2006; 47: 931-943Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Studies using qRT-PCR revealed that Plin2 transcript levels, in livers of WT mice, were at least 30-fold greater than those of other PLIN family members (Fig. 1B), indicating that Plin2 is the most highly expressed PLIN family member in livers from mice. To fully characterize how exon 5 removal affects Plin2 transcript properties, we probed hepatic RNA with primers that included the boundaries of exons 1–2 and exons 4–5, and exon 8. We did not detect exon 4–5 or exon 8 Plin2 transcripts in hepatic RNA from Plin2(Δ5) mice (Fig. 1C), confirming that loss of exon 5 disrupts transcription of downstream exons (Fig. 1A). We were able to detect low levels of Plin2 mRNA at the exon 1–2 junction. However, levels of this product were less than 10% of that obtained from hepatic RNA of WT mice, indicating that loss of exon 5 also impairs upstream exon transcription and/or processing. To determine whether mice harboring the Plin2(Δ5) mutation produce a protein product, we probed liver extracts from fasted and refed WT and Plin2(Δ5) mice with antibodies specific to N-terminal and C-terminal sequences of mouse Plin2 (15Russell T.D. Palmer C.A. Orlicky D.J. Bales E.S. Chang B.H. Chan L. McManaman J.L. Mammary glands of adipophilin-null mice produce an amino-terminally truncated form of adipophilin that mediates milk lipid droplet formation and secretion.J. Lipid Res. 2008; 49: 206-216Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Figure 1D demonstrates that both antibodies detected a band in extracts of WT livers corresponding in size to that of full-length Plin2. However, neither antibody detected bands in liver extracts from Plin2(Δ5) mice, which is consistent with the absence of Plin2 protein expression in these animals. Additionally, the relative mRNA levels of other PLIN family members in Plin2(Δ5) livers were comparable to thosefound in WT livers (Fig. 1B), suggesting that disruption of the Plin2 locus does not induce compensatory changes in expression of other PLIN proteins in livers of fasted and refed mice. Having established that Plin2(Δ5) mice lack detectable amounts of Plin2, we next investigated the effects of Plin2 loss on body fat accumulation in response to HF diet feeding. Like other Plin2-deficient strains (19Russell T.D. Schaack J. Orlicky D.J. Palmer C. Chang B.H. Chan L. McManaman J.L. Adipophilin regulates maturation of cytoplasmic lipid droplets and alveolae in differentiating mammary glands.J. Cell Sci. 2011; 124: 3247-3253Crossref PubMed Scopus (49) Google Scholar), we found that Plin2(Δ5) females had difficulty raising their first litters. We are currently investigating the nature of this defect. However, Plin2(Δ5) mice derived from subsequent pregnancies had normal viability and growth rates, and by 8 weeks of age, when HF feeding was started, their body weights were similar to those of WT mice (Fig. 2A). We examined the effects of a high caloric diet in cohorts of 8 week-old male WT and Plin2(Δ5) mice utilizing a low-fat (LF) diet (10% fat calories) or a HF diet (60% fat calories) for 8 to 12 weeks (Fig. 2). We found that providing mice ad libitum with a LF diet increased the average weights of both WT and Plin2(Δ5) mice by about 20% after 8 weeks (Fig. 2B). These weights were not significantly different from each other (P = 0.43), thus demonstrating that Plin2 loss does not affect weight gains on a LF diet. However, on a HF diet, Plin2(Δ5) mice gained significantly less weight than did WT mice over an 8–12 week feeding period (Fig. 2A, B). The body weights of WT mice on the HF diet increased by 16 g after 8 weeks and 22 g after 12 weeks (Fig. 2A, inset), whereas the weights of Plin2(Δ5) mice on the HF diet increased by only 8 g after 8 weeks and only 14 g after 12 weeks. Beginning on week 5 of HF feeding, the body weights of WT mice were significantly (P < 0.05) greater than those of Plin2(Δ5) mice. These results suggest that Plin2 loss selectively reduces weight gains associated with HF feeding in male mice. We performed similar studies in female mice and found that although females weighed much less than males, the average body weights and the percent weight gain of Plin2(Δ5) females fed the HF diet were also significantly less (P < 0.01) than those of HF-fed WT females (Fig. 2C). To determine whether the decreased weight gain observed in HF-fed Plin2(Δ5) mice was associated with selective reduction of fat mass, we quantified the amounts of lean and fat mass in WT and Plin2(Δ5) mice fed the HF diet for 9 weeks (Fig. 3A). Whereas fat mass averages for Plin2(Δ5) mice were 60% (P < 0.003) less than those of WT controls, Plin2 loss did not appear to affect lean mass quantities (Fig. 3A). For WT and Plin2(Δ5) males on the HF diet, lean mass values after 9 weeks on the diet were comparable to their starting lean masses (Fig. 3B). In contrast, fat mass values for WT males increased by nearly 275%, whereas fat mass values for Plin2(Δ5) mice increased by only about 40% (Fig. 3B). We also investigated whether the failure to detect effects on HF diet-induced weight gains and body fat mass in other models of Plin2 deficiency (12Chang B.H. Li L. Paul A. Taniguchi S. Nannegari V. Heird W.C. Chan L. Protection against fatty liver but normal adipogenesis in mice lacking adipose differentiation-related protein.Mol. Cell. Biol. 2006; 26: 1063-1076Crossref PubMed Scopus (256) Google Scholar, 13Imai Y. Varela G.M. Jackson M.B. Graham M.J. Crooke R.M. Ahima R.S. Reduction of hepatosteatosis and lipid levels by an adipose differentiation-related protein antisense oligonucleotide.Gastroenterology. 2007; 132: 1947-1954Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar) was related to differences in the genetic models used for disrupting Plin2 expression, or to the length of the HF feeding periods. We compared the relative weight gains of 8 week-old male mice fed LF or HF diets for 8 weeks (Fig. 3C). Weight gain of Plin2(Δ2,3) mice had previously been compared with WT mice on a 45% fat diet for only 4 weeks (12Chang B.H. Li L. Paul A. Taniguchi S. Nannegari V. Heird W.C. Chan L. Protection against fatty liver but normal adipogenesis in mice lacking adipose differentiation-related protein.Mol. Cell. Biol. 2006; 26: 1063-1076Crossref PubMed Scopus (256) Google Scholar). The weights of WT and Plin2(Δ2,3) mice both increased by approximately 20% over their starting values on the LF diet; and at 9 weeks, their weights were not statistically different. In contrast, on the HF diet, the relative weight gains of Plin2(Δ2,3) mice after 9 weeks (30%) were significantly (P < 0.01) less than those of WT mice (60%) (Fig. 3C). Similar to HF-fed Plin2(Δ5) mice, Plin2(Δ2,3) mice had significantly lower fat mass values (P < 0.01) than their WT counterparts (Fig. 3D) after 9 weeks of feeding, and significantly greater lean mass values (P < 0.01). We also found that female Plin2(Δ5) mice were similarly protected against the dramatic increase in fat mass as compared with WT mice (Fig. 3E). Thus, in mice, the effects of Plin2 loss on HF diet gains in adiposity appear to be independent of both gender and genetic models. Consistent with decreased amounts of body fat, we found that overnight fasting serum leptin levels in HF-fed Plin2(Δ5) mice were about a third of those found in WT mice (P < 0.04) (Table 1). We also found that fasting levels of serum insulin were lower in Plin2(Δ5) mice compared with WT mice, although the difference did not reach statistical significance (P = 0.07) (Table 2).TABLE 2Liver pathology scores for HF-fed animalsPathology scoreWT0123Macrosteatosis5200Microsteatosis1060Fibrosis6100Microgranulomas6100Inflammation7000Ballooning7000Pathology scoreD5K00123Macrosteatosis7000Microsteatosis7000Fibrosis7000Microgranulomas7000Inflammation7000Ballooning7000Liver pathologies of 12 week HF-fed WT and Plin2(Δ5) mice were evaluated using a modified Kleiner/Brunt scoring system (26Orlicky D.J. Roede J.R. Bales E. Greenwood C. Greenberg A. Petersen D. McManaman J.L. Chronic ethanol consumption in mice alters hepatocyte lipid droplet properties.Alcohol. Clin. Exp. Res. 2011; 35: 1020-1033Crossref PubMed Scopus (43) Google Scholar) on a scale of 0–3. The numbers indicate the number of animals with a particular pathological score. Open table in a new tab Liver pathologies of 12 week HF-fed WT and Plin2(Δ5) mice were evaluated using a modified Kleiner/Brunt scoring system (26Orlicky D.J. Roede J.R. Bales E. Greenwood C. Greenberg A. Petersen D. McManaman J.L. Chronic ethanol consumption in mice alters hepatocyte lipid droplet properties.Alcohol. Clin. Exp. Res. 2011; 35: 1020-1033Crossref PubMed Scopus (43) Google Scholar) on a scale of 0–3. The numbers indicate the number of animals with a particular pathological score. To determine whether the resistance of Plin2(Δ5) mice to HF diet-induced weight gains was associated with alterations in energy consumption and/or expenditure, we compared food intake, energy expenditure, and activity levels